Y.K.O. Community Postings
This site is intended to enable users of the Y.K.O. mutant collection to share
B information about the collection. A brief description about these pages
is here.
If you would like to add to this page, click here
I've had some difficulty working with the BY4741 sae2::Kan strain, consistent with this locus being rearranged. Proximally-placed intergenic primers do not amplify the locus; distally placed primers do. The resulting DNA fragment does not subsequently integrate at the Sae2 locus in other strains. It integrates at a single undetermined (non-Sae2) site.
Sandra Pennington <spenning@gs.washington.edu>
USA - Thursday, September 01, 2005 at 14:41:29 (PDT)
We just ordered the Mata yeast knockout collection. We were dismayed to find out that the key to the collection lists only yeast "y-names". Has anyone systematically updated the key to include the 3 letter yeast names. If so, would they be willing to share it with us?
Thanks, Kate
Kate Abruzzi <katea@brandeis.edu>
USA - Monday, May 23, 2005 at 08:47:42 (PDT)
Dear all,
I would like to order two yeast deletion strains from your collection but I can't access to the ordering form. Could you help me?
Best regards,
Charpentier Myriam
Universitaet Muenchen
Department Biologie I
Bereich Genetik
Maria-Ward Strass.1a
80638 Muenchen
Tel: + 49 89 21806163
charpentier Myriam <mycharp78@yahoo.com>
Germany - Monday, November 08, 2004 at 06:03:14 (PST)
are all of you scientist on yeast?
I have a question ta ask
If I knock out just one base on the HSF1,what consequences could be expected?
forget to tell something about me .I am just a sophomore in zhejiang university in China.so please do explain with plain English.thank you
Binyue <leffgh@163.com>
China - Saturday, August 14, 2004 at 18:39:45 (PDT)
1.How much do the strains of pep4 gene deletion of Saccharomyces cerevisiae cost?such as BY4741,BY4742, etc.
2.Could you tell me some background formation of these strains?
Wang Zhao-Yue <wzy5806@sohu.com>
China - Thursday, June 24, 2004 at 19:29:08 (PDT)
In reply to madhuri dutta: YES. Especially repeatedly passaged haploid or homozygous diploid mutants that are slow growers. Heterozygous diploids have less to worry about. Also, unless you have verified the cells you are testing have the correct deletion by PCR or tag sequencing, you may be testing another deletion mutant that has contaminated your well. Again slow growers are of higher concern. Contamination is easy to check/solve, but it is also possible for supressor mutations to appear over time. That can be solved by pulling the strain from a primary stock, or re-generating the mutant by transformation of the deletion construct (PCR from haploid with flanking primers), or by sporulation of the het diploid.
Brian Peyser <NOTbpeyser@NOTjhmi.edu>
USA - Wednesday, May 26, 2004 at 12:27:45 (PDT)
is there any way the knock out cell may revert to its wild type through any manner if possible?
madhuri dutta <mdutta@mednet.ucla.edu>
USA - Monday, May 24, 2004 at 17:35:13 (PDT)
I am trying to delete the rho family members -Rho1-5 in the GC1945 strain. Has anybody tried to use deletion primers constructed for BY4741 series from deletion website on another strain..
It would be very kind of you if you could help me with this problem.
Best Regards,
Korkut Vata
Department of Pathology
Division of Cardiology
Duke University
413 Sands Building
Research Drv.
Durham / NC / 27710
USA
Lab: (919)-684-2802
Korkut Vata <kcvata@hotmail.com>
USA - Wednesday, February 11, 2004 at 08:42:28 (PST)
My comment below would be more legible if newline characters weren't removed! Sorry. :(
Brian Peyser <NOTbpeyser@NOTjhmi.edu>
USA - Tuesday, December 09, 2003 at 17:10:38 (PST)
I found an inconsistency in the tag sequence annotations. The following tag sequence:
CCAGCCTGTAAAGGTGTCGA
is listed as the UPTAG for YDR074W and the UPTAG for YCL038C. Searching the tag sequence query site at http://www-deletion.stanford.edu/cgi-bin/tag_sequences/tagsequence.cgi returns strains for both ORFs.
The DOWNTAGs for each deletion mutant are unique. YDR074W DOWNTAG is CCAACTCGGGTTAATGGATG, and the DOWNTAG for that YCL038C is CCTGTAGAATAAGGCTCAAC. Additionally, YCL038C was knocked out twice, with unique UPTAG and DOWNTAG sequences for the second knockout. (UPTAG=GGTTCTACACACCATAATGC, DOWNTAG=CACCTTTCGAGAGGACGATG)
Therefore, there are three strains involved in this issue: one YDR074W strain with non-unique UPTAG and unique DOWNTAG, one YCL038C with non-unique UPTAG and unique DOWNTAG, and one YCL038C with unique UPTAG and unique DOWNTAG.
However, the deletion mutant search page at http://www-deletion.stanford.edu/cgi-bin/deletion/search3.pl lists only one pair of tags for YCL038C, which correspond to the unique tags.
I have not confirmed that the sequences listed in the data files are the sequences that are present in the deletion mutants.
Can anyone add insight to this issue? This is the only case of two different ORFs being tagged with the same sequence in the data files that I have. Does anyone know if the YCL038C strain with the duplicated UPTAG was removed from the collection? My info lists its location as Plate 5, Well C8, and the location for the uniquely tagged YCL038C as 56E3. This is obviously different than the location listed in the "Research_Genetics_Master_Table" which only has one strain for YCL038C at 245D7.
Cheers,
Brian Peyser
P.S. remove NOT from email address to correspond, unless you are a worthless spammer. :)
Brian Peyser <NOTbpeyser@NOTjhmi.edu>
USA - Tuesday, December 09, 2003 at 17:09:11 (PST)
We are sequencing a random assortment of downtags. Many of them have missense
mutantions or small deletions.
Eric Grote
USA - Monday, May 19, 2003 at 12:22:37 (PDT)
How can I read the postings
Eric Grote <egrote@jhsph.edu>
USA - Monday, May 19, 2003 at 12:17:02 (PDT)
We have a problem in using the yeast deletion knockout set. We tried to do genomic tagging for several knockout strains and could not get it to work. But if we use the common lab strain it worked perfectly. We did sporulation to the heterozygote and got the deletion and wild type haploid. We have the problems in using both
the deletion wild type haploid to do genomic tagging. I am wondering if those deletion strains are manipulated to prevent doing such kind
of work. If anybody can help, I am really appreciated.
Zhihua Li <zhihuali@mail.utexas.edu>
USA - Wednesday, May 14, 2003 at 23:04:16 (PDT)
OpenBioSystems is the newest distributor of strains.
user
USA - Wednesday, February 05, 2003 at 15:16:09 (PST)
Has anybody tested the SNF2 deletion strain? How does it look like!? I have tested this snf2 deletion strain(BY4741, yor290c/snf2, 1568). It doesn't behave
itself !
Anybody has any comments?
Lei <lzhang@lamar.colostate.edu>
USA - Friday, April 04, 2003 at 07:30:11 (PST)
The following strains are supposed to be benomyl supersensitive, but were actually not more sensitive than the wt strain of the collection:
PAC2; KIP3; RNR4; CBF1; DYN1; ROM2; RHO2; MCK1.
The following strains display the correct phenotype (benomyl ss):
GIM4; BEM2; BIM1; PAC10; MAD3; GIM5; TUB3; CIN4; ALF1; GIM3; RBL2; CIN1; CIN2.
Although the benomyl sensitivity could be background-dependant; another alternative is that there is a problem with the deletions.
Valerie Denis <vdenis@leland.stanford.edu>
USA - Tuesday, November 26, 2002 at 15:30:12 (PST)
it might be useful to use # instead of @ to thwart web-bots from culling weblists for email addresses!
angela
USA - Friday, November 22, 2002 at 14:20:25 (PST)
YER016W deletion(BIM 1) causes chromosomal instability. Homozygous diploid on occassion can mate. Checked at Stanford.
Angela <goddess@cmgm.stanford.edu>
USA - Tuesday, October 01, 2002 at 14:37:04 (PDT)
Strain 1164 (erg24) seems to synthesize ergosterol, verified by peacks at 280nm on the uv spectrum. (information submitted by Dr. Prakash/India via email)
Angela <goddess@cmgm.stanford.edu>
USA - Tuesday, October 01, 2002 at 13:54:59 (PDT)
Three ORFs that were sequenced at Fox Chase had some discrepancies in their uptags.
1)YBR203W -- ACCAGACCTCATAGCAAGTT -- ACAGACCTCATAGCAAGTT -- deletion
2)YDR428C -- CAACCAGTGGACGGTAATCG -- CAACTAGTGGACGGTAATCT -- base change
3)YBR280C -- AGTGATCTCGCAGCTCGACA -- AGTGATCTCGCACTCGACA -- deletion
Goddess <goddess@cmgm.staford.edu>
USA - Tuesday, August 27, 2002 at 17:41:22 (PDT)
Back
to the Yeast Deletion Home Page
Add
your contribution